![[personal profile]](https://www.dreamwidth.org/img/silk/identity/user.png)



Yesterday's osteo-archaeology exhibition was great and crowded with children, punks, housewives and doctors: all trying to be the best bone deformity spotter they could be. We turned out to be extremely good at sexing and ageing skeletons, but really a bit crap at spotting anything other than congenital syphilis or healed breaks. Perused a bit of the permanent collection of misc. stuff hoarded by Henry himself afterwards. Lots of fun.
My antibody blocking experiment worked nicely; I know now that my antibody does at least bind the protein that I am looking for. Now to buy blocking peptides for the other proteins that might cross-react with the antibody. Also getting the hang of primer design thanks to Primer 3 which does an awful lot of the legwork for you. Am still messing about with A4 sheets that go ACCGTCTAAAACGCGCGCTTAACGATATACAGAGA etc etc and scribbling on them with biro though.
Am currently trying my hand at peyote stitch and browsing glass beads on ebay in my lunchbreak and plotting how to drag myself up for tonight's Tranny Rally. I want sideburns.